#METABOLOMICS WORKBENCH UTM_20211104_100712 DATATRACK_ID:2916 STUDY_ID:ST001994 ANALYSIS_ID:AN003251 PROJECT_ID:PR001267
VERSION             	1
CREATED_ON             	November 22, 2021, 10:00 am
#PROJECT
PR:PROJECT_TITLE                 	Mutasynthetic production and antimicrobial characterisation of Darobactin
PR:PROJECT_TITLE                 	darobactin analogs_NMR analysis
PR:PROJECT_SUMMARY               	There is great need for therapeutics against multi-drug resistant, Gram-negative
PR:PROJECT_SUMMARY               	bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that
PR:PROJECT_SUMMARY               	selectively kills Gram-negative bacteria by targeting the outer-membrane protein
PR:PROJECT_SUMMARY               	BamA, was discovered. Its efficacy was proven in animal infection models of
PR:PROJECT_SUMMARY               	Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus
PR:PROJECT_SUMMARY               	promoting darobactin A as a promising lead compound. Originally discovered from
PR:PROJECT_SUMMARY               	members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene
PR:PROJECT_SUMMARY               	cluster (BGC) encoding for the synthesis of darobactin A can also be found in
PR:PROJECT_SUMMARY               	other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which
PR:PROJECT_SUMMARY               	differ in their core sequence from darobactin A, were identified in silico. Even
PR:PROJECT_SUMMARY               	though production of these analogs was not observed in the putative producer
PR:PROJECT_SUMMARY               	strains, we were able to generate them by mutasynthetic derivatization of a
PR:PROJECT_SUMMARY               	heterologous expression system. The generated analogs were isolated and tested
PR:PROJECT_SUMMARY               	for their bioactivity. The most potent compound, darobactin B, was used for
PR:PROJECT_SUMMARY               	co-crystallization with the target BamA, revealing an identical binding site to
PR:PROJECT_SUMMARY               	darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and
PR:PROJECT_SUMMARY               	was slightly more active against Acinetobacter baumanii isolates than darobactin
PR:PROJECT_SUMMARY               	A. Furthermore, we evaluated the plasma protein binding of darobactin A and B,
PR:PROJECT_SUMMARY               	indicating their different pharmacokinetic properties. This is the first report
PR:PROJECT_SUMMARY               	on new members of this new antibiotics class, which is likely to expand to
PR:PROJECT_SUMMARY               	several promising therapeutic candidates
PR:INSTITUTE                     	Justus-Liebig-University Giessen
PR:LABORATORY                    	Schäberle Laboratory
PR:LAST_NAME                     	Mettal
PR:FIRST_NAME                    	Ute
PR:ADDRESS                       	Ohlebergsweg 12, 35392 Giessen, Germany
PR:EMAIL                         	Ute.Mettal@chemie.uni-giessen.de
PR:PHONE                         	+49 641 97219 142
PR:PUBLICATIONS                  	Mutasynthetic production and antimicrobial characterisation of Ddarobactin
PR:PUBLICATIONS                  	analogs
PR:CONTRIBUTORS                  	Nils Böhringer, Robert Green, Yang Liu, Ute Mettal, Michael Marner, Seyed Majed
PR:CONTRIBUTORS                  	Modaresi, Roman P. Jakob, Zerlina G. Wuisan, Timm Maier, Akira Iinishi,
PR:CONTRIBUTORS                  	Sebastian Hiller, Kim Lewis, Till F. Schäberle
#STUDY
ST:STUDY_TITLE                   	Mutasynthetic production and antimicrobial characterisation of Darobactin
ST:STUDY_TITLE                   	darobactin analogs (NMR analysis)
ST:STUDY_SUMMARY                 	There is great need for therapeutics against multi-drug resistant, Gram-negative
ST:STUDY_SUMMARY                 	bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that
ST:STUDY_SUMMARY                 	selectively kills Gram-negative bacteria by targeting the outer-membrane protein
ST:STUDY_SUMMARY                 	BamA, was discovered. Its efficacy was proven in animal infection models of
ST:STUDY_SUMMARY                 	Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus
ST:STUDY_SUMMARY                 	promoting darobactin A as a promising lead compound. Originally discovered from
ST:STUDY_SUMMARY                 	members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene
ST:STUDY_SUMMARY                 	cluster (BGC) encoding for the synthesis of darobactin A can also be found in
ST:STUDY_SUMMARY                 	other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which
ST:STUDY_SUMMARY                 	differ in their core sequence from darobactin A, were identified in silico. Even
ST:STUDY_SUMMARY                 	though production of these analogs was not observed in the putative producer
ST:STUDY_SUMMARY                 	strains, we were able to generate them by mutasynthetic derivatization of a
ST:STUDY_SUMMARY                 	heterologous expression system. The generated analogs were isolated and tested
ST:STUDY_SUMMARY                 	for their bioactivity. The most potent compound, darobactin B, was used for
ST:STUDY_SUMMARY                 	co-crystallization with the target BamA, revealing an identical binding site to
ST:STUDY_SUMMARY                 	darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and
ST:STUDY_SUMMARY                 	was slightly more active against Acinetobacter baumanii isolates than darobactin
ST:STUDY_SUMMARY                 	A. Furthermore, we evaluated the plasma protein binding of darobactin A and B,
ST:STUDY_SUMMARY                 	indicating their different pharmacokinetic properties. This is the first report
ST:STUDY_SUMMARY                 	on new members of this new antibiotics class, which is likely to expand to
ST:STUDY_SUMMARY                 	several promising therapeutic candidates
ST:INSTITUTE                     	Justus-Liebig-University Giessen
ST:LABORATORY                    	Schäberle Laboratory
ST:LAST_NAME                     	Mettal
ST:FIRST_NAME                    	Ute
ST:ADDRESS                       	Ohlebergsweg 12, 35392 Giessen, Germany
ST:EMAIL                         	Ute.Mettal@chemie.uni-giessen.de
ST:PHONE                         	+49 641 97219 142
#SUBJECT
SU:SUBJECT_TYPE                  	Bacteria
SU:SUBJECT_SPECIES               	Escherichia coli
SU:TAXONOMY_ID                   	679895
SU:GENOTYPE_STRAIN               	BW25113
#SUBJECT_SAMPLE_FACTORS:         	SUBJECT(optional)[tab]SAMPLE[tab]FACTORS(NAME:VALUE pairs separated by |)[tab]Raw file names and additional sample data
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184024	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAAAAGCTTC | Reverse Primer:TTTAGAAGCTTTTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroA; Plasmid=pNBDaroMod
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184025	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGACAAAAAGATTC | Reverse Primer:TTTAGAATCTTTTTGTCCAGTTCCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroB; Plasmid=pNBDaroMod
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184026	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAGATCATTC | Reverse Primer:TTTAGAATGATCTTGACCATGACCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroC; Plasmid=pNBDaroMod
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184027	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAGAAGCTTC | Reverse Primer:TTTAGAAGCTTCTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroD; Plasmid=pNBDaroMod
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184028	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAAGAGCTTC | Reverse Primer:TTTAGAAGCTCTTTGACCATGACCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroE; Plasmid=pNBDaroMod
SUBJECT_SAMPLE_FACTORS           	E. coli BW25113	SA184029	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAAGTGGTCAAAGAATCTT | Reverse Primer:TTTAAAGATTCTTTGACCACTTCCAGGCCGTGATCTCAGGGATCT	RAW_FILE_NAME=DaroF; Plasmid=pNBDaroMod
#COLLECTION
CO:COLLECTION_SUMMARY            	E. coli strains for cloning and expression were grown in LB broth or on agar
CO:COLLECTION_SUMMARY            	medium supplemented with appropriate antibiotics or supplements at 37° C or
CO:COLLECTION_SUMMARY            	30° C using standard working concentrations. Plasmid DNA was isolated using the
CO:COLLECTION_SUMMARY            	innuPREP plasmid mini kit 2.0 (AnalytikJena, Jena, Germany) according to the
CO:COLLECTION_SUMMARY            	manufacturer’s protocol. Genomic DNA was extracted using the innuPREP
CO:COLLECTION_SUMMARY            	bacteriaDNA kit (AnalytikJena, Jena, Germany). PCR amplification for cloning
CO:COLLECTION_SUMMARY            	purposes was performed using Q5 DNA polymerase (NEB Biolabs, New Brunswick, USA)
CO:COLLECTION_SUMMARY            	according to the given instruction. Restriction digestion was performed using
CO:COLLECTION_SUMMARY            	standard techniques and employing NEB enzymes (NEB Biolabs, New Brunswick, USA).
CO:COLLECTION_SUMMARY            	DNA fragments were analysed on and excised from 1% or 2% TAE-agarose with
CO:COLLECTION_SUMMARY            	GeneRuler 1kb Plus (ThermoFisher, Waltham, USA) as marker. DNA for cloning
CO:COLLECTION_SUMMARY            	purposes was purified using the Zymoclean large fragment DNA recovery kit
CO:COLLECTION_SUMMARY            	according to manufacturer’s instruction. DNA concentrations were determined
CO:COLLECTION_SUMMARY            	photometrically with an Eppendorf BioSpectrometer (Eppendorf AG, Hamburg,
CO:COLLECTION_SUMMARY            	Germany) using a 1 mm light path UV cuvette. DNA fragments to be fused by
CO:COLLECTION_SUMMARY            	isothermal assembly were gel purified and fused using self-made isothermal
CO:COLLECTION_SUMMARY            	assembly master mix (Nat Methods 2009, 6, 343–345) using NEB enzymes (NEB
CO:COLLECTION_SUMMARY            	Biolabs, New Brunswick, USA). Assembled plasmids were transferred to E. coli
CO:COLLECTION_SUMMARY            	cells using standard electroporation protocols (Nature 2019, 576, 459-464, Metab
CO:COLLECTION_SUMMARY            	Eng 2021, 66, 123-136). Construcion of pNBDaroMod for modification of the
CO:COLLECTION_SUMMARY            	precursor peptide was performed by linearising pNB03 (Nature 2019, 576, 459-464)
CO:COLLECTION_SUMMARY            	by PCR using 5’ TCCCTTAACGTGAGTTTTCG-3’/
CO:COLLECTION_SUMMARY            	5’-TTTTATAACCTCCTTAGAGCTCGAA-3’, amplification of truncated (3’ minus 50
CO:COLLECTION_SUMMARY            	nt) darA using 5’ GCTCTAAGGAGGTTATAAAAATGCATAATACCTTAAATGAAACCGTTAAA-3’/
CO:COLLECTION_SUMMARY            	5’-TAGGTTTATTGCTTAATTCGTTTAGTGCTT-3’, the lacZ spacer from pCRISPOMYCES-2
CO:COLLECTION_SUMMARY            	(5’ CGAATTAAGCAATAAACCTAAAGTCTTCTCAGCCGCTACA-3’/ 5’
CO:COLLECTION_SUMMARY            	ACCTGATGGGATAAGCTTTAATGTCTTCACCGGTGGAAAG-3’) and the rest of the P. khanii
CO:COLLECTION_SUMMARY            	DSM3369 BGC using 5’-TAAAGCTTATCCCATCAGGTTATTT-3’/ 5’
CO:COLLECTION_SUMMARY            	CGAAAACTCACGTTAAGGGATTACGCCGCGATGGTTTGTTTTATT-3’ and subsequent isothermal
CO:COLLECTION_SUMMARY            	assembly of the plasmid. After transformation and selection on
CO:COLLECTION_SUMMARY            	LBKan/Apra/IPTG/X-gal, blue colonies were picked and the correct assembly of the
CO:COLLECTION_SUMMARY            	plasmid was corroborated by test restriction. AA modifications were designed in
CO:COLLECTION_SUMMARY            	silico and ordered as complementary oligonucleotides with 4 nt overlap to the
CO:COLLECTION_SUMMARY            	pNBDaroMod backbone. Oligonucleotides were annealed and assembled into
CO:COLLECTION_SUMMARY            	pNBDaroMod using the protocol described in ACS Synth Biol 2015, 4, 723-728 and
CO:COLLECTION_SUMMARY            	the resulting plasmids were transferred to E. coli BW25113 and selected on
CO:COLLECTION_SUMMARY            	LBKan/Apra/IPTG/X-gal. White colonies were picked and grown in LBKan/IPTG for
CO:COLLECTION_SUMMARY            	three days at 220 rpm and 30° C. The correct assembly of the plasmid was
CO:COLLECTION_SUMMARY            	corroborated by UHPLC-MS profiling, i.e. detection of the expected product ion.
CO:COLLECTION_SUMMARY            	For increased production titter, the modified BGCs were recloned into pRSF-duett
CO:COLLECTION_SUMMARY            	using the primers 5’-GTATAAGAAGGAGATATACAATGCATAATACCTTAAATGA-3’/ 5’
CO:COLLECTION_SUMMARY            	TGCTCAGCGGTGGCAGCAGCTTACGCCGCGATGGTTTGTT-3’ for all constructs to match the
CO:COLLECTION_SUMMARY            	layout of pRSF-ADC5 and produced in E. coli Bap1 (Metab Eng 2021, 66, 123-136).
CO:COLLECTION_PROTOCOL_FILENAME  	Collection Protocol_Mutasynthetic production of darobactin analogs.docx
CO:SAMPLE_TYPE                   	Bacterial cells
#TREATMENT
TR:TREATMENT_SUMMARY             	Purification of DaroB from the producer strain was achieved with a modified
TR:TREATMENT_SUMMARY             	purification strategy from DaroA. Briefly, E. coli production strains were
TR:TREATMENT_SUMMARY             	incubated for 5 days in a 2 L Erlenmeyer flask with 1 L LB medium supplemented
TR:TREATMENT_SUMMARY             	with 50 μg/mL kanamycin at 30 °C. Cells were removed via centrifugation and
TR:TREATMENT_SUMMARY             	the culture supernatant was mixed with XAD16N resin (Sigma-Aldrich) overnight
TR:TREATMENT_SUMMARY             	under agitation. DaroB was subsequently eluted from the resin with a 50/50
TR:TREATMENT_SUMMARY             	solution of methanol and water, containing 0.1% formic acid. The eluate was then
TR:TREATMENT_SUMMARY             	concentrated via rotary evaporator and loaded onto a cation-exchange column (SP
TR:TREATMENT_SUMMARY             	Sepharose XL). DaroB was eluted by step gradients of 50 mM ammonium acetate pH
TR:TREATMENT_SUMMARY             	7, pH 8, and pH 10. Eluates were then concentrated by freeze drying, resuspended
TR:TREATMENT_SUMMARY             	in Milli-Q water 0.1% (v/v) formic acid, and loaded onto a C18 reversed-phase
TR:TREATMENT_SUMMARY             	high-performance liquid chromatography (RP-HPLC) column (Agilent, C18 5 µm: 250
TR:TREATMENT_SUMMARY             	x10mm, Restek). HPLC conditions for purification of DaroB are: solvent A,
TR:TREATMENT_SUMMARY             	Milli-Q water and 0.1% (v/v) formic acid; solvent B, acetonitrile and 0.1% (v/v)
TR:TREATMENT_SUMMARY             	formic acid. The initial concentration of 2% solvent B is maintained for 2 min,
TR:TREATMENT_SUMMARY             	followed by a linear gradient to 26% B over 12 min with a flow rate of 5 mL
TR:TREATMENT_SUMMARY             	min−1; UV detection by diode-array detector from 210 to 400 nm. Pure DaroB was
TR:TREATMENT_SUMMARY             	then collected at 11.5 min. For purification of DaroE, fermentation broth was
TR:TREATMENT_SUMMARY             	pelleted by centrifugation. The cell pellet was extracted using 80% acetonitrile
TR:TREATMENT_SUMMARY             	and water by sonification. The resulting crude extract was fractionated by flash
TR:TREATMENT_SUMMARY             	chromatography using a C18 F0120 column with the following gradient: 1) 0-28 min
TR:TREATMENT_SUMMARY             	5% ACN, 2) 28-37 min increased to 15% ACN, 3) 37-50 min, keeping 15% ACN, 4)
TR:TREATMENT_SUMMARY             	50-60 min, increased to 30% ACN, 5) 60-80 min, increased to 100% ACN and keeping
TR:TREATMENT_SUMMARY             	100% ACN for 15 min. By LCMS guided isolation, the DaroE-containing fraction was
TR:TREATMENT_SUMMARY             	identified and further separated by HPLC using the following gradient: 1) 0-10
TR:TREATMENT_SUMMARY             	min 23% MeOH, 2)10-20 min increased to 50% MeOH, 3) 20-30 min increased to 100%
TR:TREATMENT_SUMMARY             	MeOH, 4) 30-37 min 100% MeOH. Afterwards, the DaroE fraction was further
TR:TREATMENT_SUMMARY             	purified by HPLC (gradient: 1) 0-5 min 25 %MeOH, 2) 5-45 min increased to 42.5%
TR:TREATMENT_SUMMARY             	MeOH, 3) 45-52 min keeping 100% MeOH to obtain pure compound. For DaroD the same
TR:TREATMENT_SUMMARY             	procedure via flash chromatography was followed. Then, the following HPLC
TR:TREATMENT_SUMMARY             	gradient was applied: 1) 0-5 min 15% ACN, 2) 5-25 min increased to 25% ACN, 3)
TR:TREATMENT_SUMMARY             	25-30 min increased to 60% ACN, 4) 30-39 min 100% ACN. As before, a further HPLC
TR:TREATMENT_SUMMARY             	separation followed to obtain DaroD as pure compound.
TR:TREATMENT_PROTOCOL_FILENAME   	Treatment Protocol_Isolation of compounds.docx
#SAMPLEPREP
SP:SAMPLEPREP_SUMMARY            	For NMR analysis samples were dissolved in D2O.
SP:SAMPLEPREP_PROTOCOL_FILENAME  	Sample Preparation Protocol_NMR Spectroscopy.docx
#ANALYSIS
AN:ANALYSIS_TYPE                 	NMR
#NMR
NM:INSTRUMENT_NAME               	Bruker Avance III HD 600 MHz
NM:INSTRUMENT_TYPE               	FT-NMR
NM:NMR_EXPERIMENT_TYPE           	Other
NM:NMR_COMMENTS                  	NMR spectra were recorded in D2O as solvent on an Avance III HD 600 MHz NMR
NM:NMR_COMMENTS                  	spectrometer (Bruker BioSpin GmbH, Rheinstetten, Germany). 1H spectra were
NM:NMR_COMMENTS                  	referenced to the residual solvent signal (delta = 4.79 ppm). For 13C
NM:NMR_COMMENTS                  	measurements 3-(trimethylsilyl)propionic-2,2,3,3-d4 acid sodium salt (TSPA,
NM:NMR_COMMENTS                  	delta = 1.7 ppm) was used as external standard.
NM:SPECTROMETER_FREQUENCY        	600 MHz
NM:NMR_SOLVENT                   	D2O
#NMR_METABOLITE_DATA
NMR_METABOLITE_DATA:UNITS	N/A (structure elucidation)
NMR_METABOLITE_DATA_START
Samples	SA184025
Factors	Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGACAAAAAGATTC | Reverse Primer:TTTAGAATCTTTTTGTCCAGTTCCAGGCCGTGATCTCAGGGATCT
Darobactin B	
NMR_METABOLITE_DATA_END
#METABOLITES
METABOLITES_START
metabolite_name	sample_name	m/z [M+2H]2+ observed	m/z [M+2H]2+ calculated	RT(min)	Chemical Formula	H1 chemical shifts(ppm)	C13 chemical shifts(ppm)
Darobactin B	SA184025	525.2541	525.2512	3.1	C51H64N14O11	7.90_7.50-7.45_7.51_7.43-7.36_7.30_7.24_6.99_6.24_4.77_4.74_4.34_4.22_4.08_3.77_3.60_3.43_3.37_3.35_3.33_3.17_3.14_3.10-3.00_2.24-2.17_2.16-2.09_1.98-1.89_1.85-1.77_1.77-1.72_1.72-1.64_1.58-1.45_0.83	178.98_178.12_177.43_175.85_172.97_172.64_172.59_172.40_161.13_149.59_141.58_141.07_137.41_133.86_133.50_133.46_133.23_131.65_129.34_129.28_129.15_128.88_124.68_121.87_118.24_116.09_114.95_113.45_112.56_81.34_72.46_67.81_64.51_62.52_59.11_58.52_57.81_55.19_52.40_44.88_43.84_43.29_40.99_32.73_30.72_30.13_30.01_28.83_22.73
METABOLITES_END
#END