#METABOLOMICS WORKBENCH UTM_20211104_100712 DATATRACK_ID:2916 STUDY_ID:ST001994 ANALYSIS_ID:AN003251 VERSION 1 CREATED_ON 02-08-2024 #PROJECT PR:PROJECT_TITLE Mutasynthetic production and antimicrobial characterisation of Darobactin PR:PROJECT_TITLE darobactin analogs_NMR analysis PR:PROJECT_SUMMARY There is great need for therapeutics against multi-drug resistant, Gram-negative PR:PROJECT_SUMMARY bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that PR:PROJECT_SUMMARY selectively kills Gram-negative bacteria by targeting the outer-membrane protein PR:PROJECT_SUMMARY BamA, was discovered. Its efficacy was proven in animal infection models of PR:PROJECT_SUMMARY Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus PR:PROJECT_SUMMARY promoting darobactin A as a promising lead compound. Originally discovered from PR:PROJECT_SUMMARY members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene PR:PROJECT_SUMMARY cluster (BGC) encoding for the synthesis of darobactin A can also be found in PR:PROJECT_SUMMARY other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which PR:PROJECT_SUMMARY differ in their core sequence from darobactin A, were identified in silico. Even PR:PROJECT_SUMMARY though production of these analogs was not observed in the putative producer PR:PROJECT_SUMMARY strains, we were able to generate them by mutasynthetic derivatization of a PR:PROJECT_SUMMARY heterologous expression system. The generated analogs were isolated and tested PR:PROJECT_SUMMARY for their bioactivity. The most potent compound, darobactin B, was used for PR:PROJECT_SUMMARY co-crystallization with the target BamA, revealing an identical binding site to PR:PROJECT_SUMMARY darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and PR:PROJECT_SUMMARY was slightly more active against Acinetobacter baumanii isolates than darobactin PR:PROJECT_SUMMARY A. Furthermore, we evaluated the plasma protein binding of darobactin A and B, PR:PROJECT_SUMMARY indicating their different pharmacokinetic properties. This is the first report PR:PROJECT_SUMMARY on new members of this new antibiotics class, which is likely to expand to PR:PROJECT_SUMMARY several promising therapeutic candidates PR:INSTITUTE Justus-Liebig-University Giessen PR:LABORATORY Schäberle Laboratory PR:LAST_NAME Mettal PR:FIRST_NAME Ute PR:ADDRESS Ohlebergsweg 12, 35392 Giessen, Germany PR:EMAIL Ute.Mettal@chemie.uni-giessen.de PR:PHONE +49 641 97219 142 PR:PUBLICATIONS Mutasynthetic production and antimicrobial characterisation of Ddarobactin PR:PUBLICATIONS analogs PR:DOI http://dx.doi.org/10.21228/M8XX3Q PR:CONTRIBUTORS Nils Böhringer, Robert Green, Yang Liu, Ute Mettal, Michael Marner, Seyed Majed PR:CONTRIBUTORS Modaresi, Roman P. Jakob, Zerlina G. Wuisan, Timm Maier, Akira Iinishi, PR:CONTRIBUTORS Sebastian Hiller, Kim Lewis, Till F. Schäberle #STUDY ST:STUDY_TITLE Mutasynthetic production and antimicrobial characterisation of Darobactin ST:STUDY_TITLE darobactin analogs (NMR analysis) ST:STUDY_SUMMARY There is great need for therapeutics against multi-drug resistant, Gram-negative ST:STUDY_SUMMARY bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that ST:STUDY_SUMMARY selectively kills Gram-negative bacteria by targeting the outer-membrane protein ST:STUDY_SUMMARY BamA, was discovered. Its efficacy was proven in animal infection models of ST:STUDY_SUMMARY Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus ST:STUDY_SUMMARY promoting darobactin A as a promising lead compound. Originally discovered from ST:STUDY_SUMMARY members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene ST:STUDY_SUMMARY cluster (BGC) encoding for the synthesis of darobactin A can also be found in ST:STUDY_SUMMARY other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which ST:STUDY_SUMMARY differ in their core sequence from darobactin A, were identified in silico. Even ST:STUDY_SUMMARY though production of these analogs was not observed in the putative producer ST:STUDY_SUMMARY strains, we were able to generate them by mutasynthetic derivatization of a ST:STUDY_SUMMARY heterologous expression system. The generated analogs were isolated and tested ST:STUDY_SUMMARY for their bioactivity. The most potent compound, darobactin B, was used for ST:STUDY_SUMMARY co-crystallization with the target BamA, revealing an identical binding site to ST:STUDY_SUMMARY darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and ST:STUDY_SUMMARY was slightly more active against Acinetobacter baumanii isolates than darobactin ST:STUDY_SUMMARY A. Furthermore, we evaluated the plasma protein binding of darobactin A and B, ST:STUDY_SUMMARY indicating their different pharmacokinetic properties. This is the first report ST:STUDY_SUMMARY on new members of this new antibiotics class, which is likely to expand to ST:STUDY_SUMMARY several promising therapeutic candidates ST:INSTITUTE Justus-Liebig-University Giessen ST:LABORATORY Schäberle Laboratory ST:LAST_NAME Mettal ST:FIRST_NAME Ute ST:ADDRESS Ohlebergsweg 12, 35392 Giessen, Germany ST:EMAIL Ute.Mettal@chemie.uni-giessen.de ST:PHONE +49 641 97219 142 ST:SUBMIT_DATE 2021-11-04 #SUBJECT SU:SUBJECT_TYPE Bacteria SU:SUBJECT_SPECIES Escherichia coli SU:TAXONOMY_ID 679895 SU:GENOTYPE_STRAIN BW25113 #SUBJECT_SAMPLE_FACTORS: SUBJECT(optional)[tab]SAMPLE[tab]FACTORS(NAME:VALUE pairs separated by |)[tab]Additional sample data SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184025 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGACAAAAAGATTC | Reverse Primer:TTTAGAATCTTTTTGTCCAGTTCCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroB; Plasmid=pNBDaroMod SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184024 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAAAAGCTTC | Reverse Primer:TTTAGAAGCTTTTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroA; Plasmid=pNBDaroMod SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184027 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAGAAGCTTC | Reverse Primer:TTTAGAAGCTTCTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroD; Plasmid=pNBDaroMod SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184029 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAAGTGGTCAAAGAATCTT | Reverse Primer:TTTAAAGATTCTTTGACCACTTCCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroF; Plasmid=pNBDaroMod SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184028 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAAGAGCTTC | Reverse Primer:TTTAGAAGCTCTTTGACCATGACCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroE; Plasmid=pNBDaroMod SUBJECT_SAMPLE_FACTORS E. coli BW25113 SA184026 Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAGATCATTC | Reverse Primer:TTTAGAATGATCTTGACCATGACCAGGCCGTGATCTCAGGGATCT RAW_FILE_NAME=DaroC; Plasmid=pNBDaroMod #COLLECTION CO:COLLECTION_SUMMARY E. coli strains for cloning and expression were grown in LB broth or on agar CO:COLLECTION_SUMMARY medium supplemented with appropriate antibiotics or supplements at 37° C or CO:COLLECTION_SUMMARY 30° C using standard working concentrations. Plasmid DNA was isolated using the CO:COLLECTION_SUMMARY innuPREP plasmid mini kit 2.0 (AnalytikJena, Jena, Germany) according to the CO:COLLECTION_SUMMARY manufacturer’s protocol. Genomic DNA was extracted using the innuPREP CO:COLLECTION_SUMMARY bacteriaDNA kit (AnalytikJena, Jena, Germany). PCR amplification for cloning CO:COLLECTION_SUMMARY purposes was performed using Q5 DNA polymerase (NEB Biolabs, New Brunswick, USA) CO:COLLECTION_SUMMARY according to the given instruction. Restriction digestion was performed using CO:COLLECTION_SUMMARY standard techniques and employing NEB enzymes (NEB Biolabs, New Brunswick, USA). CO:COLLECTION_SUMMARY DNA fragments were analysed on and excised from 1% or 2% TAE-agarose with CO:COLLECTION_SUMMARY GeneRuler 1kb Plus (ThermoFisher, Waltham, USA) as marker. DNA for cloning CO:COLLECTION_SUMMARY purposes was purified using the Zymoclean large fragment DNA recovery kit CO:COLLECTION_SUMMARY according to manufacturer’s instruction. DNA concentrations were determined CO:COLLECTION_SUMMARY photometrically with an Eppendorf BioSpectrometer (Eppendorf AG, Hamburg, CO:COLLECTION_SUMMARY Germany) using a 1 mm light path UV cuvette. DNA fragments to be fused by CO:COLLECTION_SUMMARY isothermal assembly were gel purified and fused using self-made isothermal CO:COLLECTION_SUMMARY assembly master mix (Nat Methods 2009, 6, 343–345) using NEB enzymes (NEB CO:COLLECTION_SUMMARY Biolabs, New Brunswick, USA). Assembled plasmids were transferred to E. coli CO:COLLECTION_SUMMARY cells using standard electroporation protocols (Nature 2019, 576, 459-464, Metab CO:COLLECTION_SUMMARY Eng 2021, 66, 123-136). Construcion of pNBDaroMod for modification of the CO:COLLECTION_SUMMARY precursor peptide was performed by linearising pNB03 (Nature 2019, 576, 459-464) CO:COLLECTION_SUMMARY by PCR using 5’ TCCCTTAACGTGAGTTTTCG-3’/ CO:COLLECTION_SUMMARY 5’-TTTTATAACCTCCTTAGAGCTCGAA-3’, amplification of truncated (3’ minus 50 CO:COLLECTION_SUMMARY nt) darA using 5’ GCTCTAAGGAGGTTATAAAAATGCATAATACCTTAAATGAAACCGTTAAA-3’/ CO:COLLECTION_SUMMARY 5’-TAGGTTTATTGCTTAATTCGTTTAGTGCTT-3’, the lacZ spacer from pCRISPOMYCES-2 CO:COLLECTION_SUMMARY (5’ CGAATTAAGCAATAAACCTAAAGTCTTCTCAGCCGCTACA-3’/ 5’ CO:COLLECTION_SUMMARY ACCTGATGGGATAAGCTTTAATGTCTTCACCGGTGGAAAG-3’) and the rest of the P. khanii CO:COLLECTION_SUMMARY DSM3369 BGC using 5’-TAAAGCTTATCCCATCAGGTTATTT-3’/ 5’ CO:COLLECTION_SUMMARY CGAAAACTCACGTTAAGGGATTACGCCGCGATGGTTTGTTTTATT-3’ and subsequent isothermal CO:COLLECTION_SUMMARY assembly of the plasmid. After transformation and selection on CO:COLLECTION_SUMMARY LBKan/Apra/IPTG/X-gal, blue colonies were picked and the correct assembly of the CO:COLLECTION_SUMMARY plasmid was corroborated by test restriction. AA modifications were designed in CO:COLLECTION_SUMMARY silico and ordered as complementary oligonucleotides with 4 nt overlap to the CO:COLLECTION_SUMMARY pNBDaroMod backbone. Oligonucleotides were annealed and assembled into CO:COLLECTION_SUMMARY pNBDaroMod using the protocol described in ACS Synth Biol 2015, 4, 723-728 and CO:COLLECTION_SUMMARY the resulting plasmids were transferred to E. coli BW25113 and selected on CO:COLLECTION_SUMMARY LBKan/Apra/IPTG/X-gal. White colonies were picked and grown in LBKan/IPTG for CO:COLLECTION_SUMMARY three days at 220 rpm and 30° C. The correct assembly of the plasmid was CO:COLLECTION_SUMMARY corroborated by UHPLC-MS profiling, i.e. detection of the expected product ion. CO:COLLECTION_SUMMARY For increased production titter, the modified BGCs were recloned into pRSF-duett CO:COLLECTION_SUMMARY using the primers 5’-GTATAAGAAGGAGATATACAATGCATAATACCTTAAATGA-3’/ 5’ CO:COLLECTION_SUMMARY TGCTCAGCGGTGGCAGCAGCTTACGCCGCGATGGTTTGTT-3’ for all constructs to match the CO:COLLECTION_SUMMARY layout of pRSF-ADC5 and produced in E. coli Bap1 (Metab Eng 2021, 66, 123-136). CO:COLLECTION_PROTOCOL_FILENAME Collection_Protocol_Mutasynthetic_production_of_darobactin_analogs.docx CO:SAMPLE_TYPE Bacterial cells #TREATMENT TR:TREATMENT_SUMMARY Purification of DaroB from the producer strain was achieved with a modified TR:TREATMENT_SUMMARY purification strategy from DaroA. Briefly, E. coli production strains were TR:TREATMENT_SUMMARY incubated for 5 days in a 2 L Erlenmeyer flask with 1 L LB medium supplemented TR:TREATMENT_SUMMARY with 50 μg/mL kanamycin at 30 °C. Cells were removed via centrifugation and TR:TREATMENT_SUMMARY the culture supernatant was mixed with XAD16N resin (Sigma-Aldrich) overnight TR:TREATMENT_SUMMARY under agitation. DaroB was subsequently eluted from the resin with a 50/50 TR:TREATMENT_SUMMARY solution of methanol and water, containing 0.1% formic acid. The eluate was then TR:TREATMENT_SUMMARY concentrated via rotary evaporator and loaded onto a cation-exchange column (SP TR:TREATMENT_SUMMARY Sepharose XL). DaroB was eluted by step gradients of 50 mM ammonium acetate pH TR:TREATMENT_SUMMARY 7, pH 8, and pH 10. Eluates were then concentrated by freeze drying, resuspended TR:TREATMENT_SUMMARY in Milli-Q water 0.1% (v/v) formic acid, and loaded onto a C18 reversed-phase TR:TREATMENT_SUMMARY high-performance liquid chromatography (RP-HPLC) column (Agilent, C18 5 µm: 250 TR:TREATMENT_SUMMARY x10mm, Restek). HPLC conditions for purification of DaroB are: solvent A, TR:TREATMENT_SUMMARY Milli-Q water and 0.1% (v/v) formic acid; solvent B, acetonitrile and 0.1% (v/v) TR:TREATMENT_SUMMARY formic acid. The initial concentration of 2% solvent B is maintained for 2 min, TR:TREATMENT_SUMMARY followed by a linear gradient to 26% B over 12 min with a flow rate of 5 mL TR:TREATMENT_SUMMARY min−1; UV detection by diode-array detector from 210 to 400 nm. Pure DaroB was TR:TREATMENT_SUMMARY then collected at 11.5 min. For purification of DaroE, fermentation broth was TR:TREATMENT_SUMMARY pelleted by centrifugation. The cell pellet was extracted using 80% acetonitrile TR:TREATMENT_SUMMARY and water by sonification. The resulting crude extract was fractionated by flash TR:TREATMENT_SUMMARY chromatography using a C18 F0120 column with the following gradient: 1) 0-28 min TR:TREATMENT_SUMMARY 5% ACN, 2) 28-37 min increased to 15% ACN, 3) 37-50 min, keeping 15% ACN, 4) TR:TREATMENT_SUMMARY 50-60 min, increased to 30% ACN, 5) 60-80 min, increased to 100% ACN and keeping TR:TREATMENT_SUMMARY 100% ACN for 15 min. By LCMS guided isolation, the DaroE-containing fraction was TR:TREATMENT_SUMMARY identified and further separated by HPLC using the following gradient: 1) 0-10 TR:TREATMENT_SUMMARY min 23% MeOH, 2)10-20 min increased to 50% MeOH, 3) 20-30 min increased to 100% TR:TREATMENT_SUMMARY MeOH, 4) 30-37 min 100% MeOH. Afterwards, the DaroE fraction was further TR:TREATMENT_SUMMARY purified by HPLC (gradient: 1) 0-5 min 25 %MeOH, 2) 5-45 min increased to 42.5% TR:TREATMENT_SUMMARY MeOH, 3) 45-52 min keeping 100% MeOH to obtain pure compound. For DaroD the same TR:TREATMENT_SUMMARY procedure via flash chromatography was followed. Then, the following HPLC TR:TREATMENT_SUMMARY gradient was applied: 1) 0-5 min 15% ACN, 2) 5-25 min increased to 25% ACN, 3) TR:TREATMENT_SUMMARY 25-30 min increased to 60% ACN, 4) 30-39 min 100% ACN. As before, a further HPLC TR:TREATMENT_SUMMARY separation followed to obtain DaroD as pure compound. TR:TREATMENT_PROTOCOL_FILENAME Treatment_Protocol_Isolation_of_compounds.docx #SAMPLEPREP SP:SAMPLEPREP_SUMMARY For NMR analysis samples were dissolved in D2O. SP:SAMPLEPREP_PROTOCOL_FILENAME Sample Preparation Protocol_NMR Spectroscopy.docx #CHROMATOGRAPHY #ANALYSIS AN:ANALYSIS_TYPE NMR #NMR NM:INSTRUMENT_NAME Bruker Avance III HD 600 MHz NM:INSTRUMENT_TYPE FT-NMR NM:NMR_EXPERIMENT_TYPE Other NM:NMR_COMMENTS NMR spectra were recorded in D2O as solvent on an Avance III HD 600 MHz NMR NM:NMR_COMMENTS spectrometer (Bruker BioSpin GmbH, Rheinstetten, Germany). 1H spectra were NM:NMR_COMMENTS referenced to the residual solvent signal (delta = 4.79 ppm). For 13C NM:NMR_COMMENTS measurements 3-(trimethylsilyl)propionic-2,2,3,3-d4 acid sodium salt (TSPA, NM:NMR_COMMENTS delta = 1.7 ppm) was used as external standard. NM:SPECTROMETER_FREQUENCY 600 MHz NM:NMR_SOLVENT D2O #NMR_METABOLITE_DATA NMR_METABOLITE_DATA:UNITS N/A (structure elucidation) NMR_METABOLITE_DATA_START Samples SA184025 Factors Forward Primer:CCTAAGATCCCTGAGATCACGGCCTGGAACTGGACAAAAAGATTC | Reverse Primer:TTTAGAATCTTTTTGTCCAGTTCCAGGCCGTGATCTCAGGGATCT Darobactin B NMR_METABOLITE_DATA_END #METABOLITES METABOLITES_START metabolite_name pubchem_id inchi_key kegg_id other_id other_id_type ri ri_type moverz_quant Darobactin B 3.1 525.2512 METABOLITES_END #END