Summary of Study ST001994
This data is available at the NIH Common Fund's National Metabolomics Data Repository (NMDR) website, the Metabolomics Workbench, https://www.metabolomicsworkbench.org, where it has been assigned Project ID PR001267. The data can be accessed directly via it's Project DOI: 10.21228/M8XX3Q This work is supported by NIH grant, U2C- DK119886.
See: https://www.metabolomicsworkbench.org/about/howtocite.php
This study contains a large results data set and is not available in the mwTab file. It is only available for download via FTP as data file(s) here.
| Study ID | ST001994 |
| Study Title | Mutasynthetic production and antimicrobial characterisation of Darobactin darobactin analogs (NMR analysis) |
| Study Summary | There is great need for therapeutics against multi-drug resistant, Gram-negative bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that selectively kills Gram-negative bacteria by targeting the outer-membrane protein BamA, was discovered. Its efficacy was proven in animal infection models of Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus promoting darobactin A as a promising lead compound. Originally discovered from members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene cluster (BGC) encoding for the synthesis of darobactin A can also be found in other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which differ in their core sequence from darobactin A, were identified in silico. Even though production of these analogs was not observed in the putative producer strains, we were able to generate them by mutasynthetic derivatization of a heterologous expression system. The generated analogs were isolated and tested for their bioactivity. The most potent compound, darobactin B, was used for co-crystallization with the target BamA, revealing an identical binding site to darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and was slightly more active against Acinetobacter baumanii isolates than darobactin A. Furthermore, we evaluated the plasma protein binding of darobactin A and B, indicating their different pharmacokinetic properties. This is the first report on new members of this new antibiotics class, which is likely to expand to several promising therapeutic candidates |
| Institute | Justus-Liebig-University Giessen |
| Laboratory | Schäberle Laboratory |
| Last Name | Mettal |
| First Name | Ute |
| Address | Ohlebergsweg 12, 35392 Giessen, Germany |
| Ute.Mettal@chemie.uni-giessen.de | |
| Phone | +49 641 97219 142 |
| Submit Date | 2021-11-04 |
| Raw Data Available | Yes |
| Raw Data File Type(s) | fid |
| Analysis Type Detail | NMR |
| Release Date | 2022-11-21 |
| Release Version | 1 |
Select appropriate tab below to view additional metadata details:
Project:
| Project ID: | PR001267 |
| Project DOI: | doi: 10.21228/M8XX3Q |
| Project Title: | Mutasynthetic production and antimicrobial characterisation of Darobactin darobactin analogs_NMR analysis |
| Project Summary: | There is great need for therapeutics against multi-drug resistant, Gram-negative bacterial pathogens. Recently, darobactin A, a novel bicyclic heptapeptide that selectively kills Gram-negative bacteria by targeting the outer-membrane protein BamA, was discovered. Its efficacy was proven in animal infection models of Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa, thus promoting darobactin A as a promising lead compound. Originally discovered from members of the nematode symbiotic genus Photorhabdus, the biosynthetic gene cluster (BGC) encoding for the synthesis of darobactin A can also be found in other γ-proteobacterial families. Therein, the precursor peptides DarB-F, which differ in their core sequence from darobactin A, were identified in silico. Even though production of these analogs was not observed in the putative producer strains, we were able to generate them by mutasynthetic derivatization of a heterologous expression system. The generated analogs were isolated and tested for their bioactivity. The most potent compound, darobactin B, was used for co-crystallization with the target BamA, revealing an identical binding site to darobactin A. Besides its potency, darobactin B did not exhibit cytotoxicity and was slightly more active against Acinetobacter baumanii isolates than darobactin A. Furthermore, we evaluated the plasma protein binding of darobactin A and B, indicating their different pharmacokinetic properties. This is the first report on new members of this new antibiotics class, which is likely to expand to several promising therapeutic candidates |
| Institute: | Justus-Liebig-University Giessen |
| Laboratory: | Schäberle Laboratory |
| Last Name: | Mettal |
| First Name: | Ute |
| Address: | Ohlebergsweg 12, 35392 Giessen, Germany |
| Email: | Ute.Mettal@chemie.uni-giessen.de |
| Phone: | +49 641 97219 142 |
| Publications: | Mutasynthetic production and antimicrobial characterisation of Ddarobactin analogs |
| Contributors: | Nils Böhringer, Robert Green, Yang Liu, Ute Mettal, Michael Marner, Seyed Majed Modaresi, Roman P. Jakob, Zerlina G. Wuisan, Timm Maier, Akira Iinishi, Sebastian Hiller, Kim Lewis, Till F. Schäberle |
Subject:
| Subject ID: | SU002075 |
| Subject Type: | Bacteria |
| Subject Species: | Escherichia coli |
| Taxonomy ID: | 679895 |
| Genotype Strain: | BW25113 |
Factors:
Subject type: Bacteria; Subject species: Escherichia coli (Factor headings shown in green)
| mb_sample_id | local_sample_id | Forward Primer | Reverse Primer |
|---|---|---|---|
| SA186762 | SA184025 | CCTAAGATCCCTGAGATCACGGCCTGGAACTGGACAAAAAGATTC | TTTAGAATCTTTTTGTCCAGTTCCAGGCCGTGATCTCAGGGATCT |
| SA186763 | SA184024 | CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAAAAGCTTC | TTTAGAAGCTTTTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT |
| SA186764 | SA184027 | CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAGAAGCTTC | TTTAGAAGCTTCTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT |
| SA186765 | SA184029 | CCTAAGATCCCTGAGATCACGGCCTGGAAGTGGTCAAAGAATCTT | TTTAAAGATTCTTTGACCACTTCCAGGCCGTGATCTCAGGGATCT |
| SA186766 | SA184028 | CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAAGAGCTTC | TTTAGAAGCTCTTTGACCATGACCAGGCCGTGATCTCAGGGATCT |
| SA186767 | SA184026 | CCTAAGATCCCTGAGATCACGGCCTGGTCATGGTCAAGATCATTC | TTTAGAATGATCTTGACCATGACCAGGCCGTGATCTCAGGGATCT |
| Showing results 1 to 6 of 6 |
Collection:
| Collection ID: | CO002068 |
| Collection Summary: | E. coli strains for cloning and expression were grown in LB broth or on agar medium supplemented with appropriate antibiotics or supplements at 37° C or 30° C using standard working concentrations. Plasmid DNA was isolated using the innuPREP plasmid mini kit 2.0 (AnalytikJena, Jena, Germany) according to the manufacturer’s protocol. Genomic DNA was extracted using the innuPREP bacteriaDNA kit (AnalytikJena, Jena, Germany). PCR amplification for cloning purposes was performed using Q5 DNA polymerase (NEB Biolabs, New Brunswick, USA) according to the given instruction. Restriction digestion was performed using standard techniques and employing NEB enzymes (NEB Biolabs, New Brunswick, USA). DNA fragments were analysed on and excised from 1% or 2% TAE-agarose with GeneRuler 1kb Plus (ThermoFisher, Waltham, USA) as marker. DNA for cloning purposes was purified using the Zymoclean large fragment DNA recovery kit according to manufacturer’s instruction. DNA concentrations were determined photometrically with an Eppendorf BioSpectrometer (Eppendorf AG, Hamburg, Germany) using a 1 mm light path UV cuvette. DNA fragments to be fused by isothermal assembly were gel purified and fused using self-made isothermal assembly master mix (Nat Methods 2009, 6, 343–345) using NEB enzymes (NEB Biolabs, New Brunswick, USA). Assembled plasmids were transferred to E. coli cells using standard electroporation protocols (Nature 2019, 576, 459-464, Metab Eng 2021, 66, 123-136). Construcion of pNBDaroMod for modification of the precursor peptide was performed by linearising pNB03 (Nature 2019, 576, 459-464) by PCR using 5’ TCCCTTAACGTGAGTTTTCG-3’/ 5’-TTTTATAACCTCCTTAGAGCTCGAA-3’, amplification of truncated (3’ minus 50 nt) darA using 5’ GCTCTAAGGAGGTTATAAAAATGCATAATACCTTAAATGAAACCGTTAAA-3’/ 5’-TAGGTTTATTGCTTAATTCGTTTAGTGCTT-3’, the lacZ spacer from pCRISPOMYCES-2 (5’ CGAATTAAGCAATAAACCTAAAGTCTTCTCAGCCGCTACA-3’/ 5’ ACCTGATGGGATAAGCTTTAATGTCTTCACCGGTGGAAAG-3’) and the rest of the P. khanii DSM3369 BGC using 5’-TAAAGCTTATCCCATCAGGTTATTT-3’/ 5’ CGAAAACTCACGTTAAGGGATTACGCCGCGATGGTTTGTTTTATT-3’ and subsequent isothermal assembly of the plasmid. After transformation and selection on LBKan/Apra/IPTG/X-gal, blue colonies were picked and the correct assembly of the plasmid was corroborated by test restriction. AA modifications were designed in silico and ordered as complementary oligonucleotides with 4 nt overlap to the pNBDaroMod backbone. Oligonucleotides were annealed and assembled into pNBDaroMod using the protocol described in ACS Synth Biol 2015, 4, 723-728 and the resulting plasmids were transferred to E. coli BW25113 and selected on LBKan/Apra/IPTG/X-gal. White colonies were picked and grown in LBKan/IPTG for three days at 220 rpm and 30° C. The correct assembly of the plasmid was corroborated by UHPLC-MS profiling, i.e. detection of the expected product ion. For increased production titter, the modified BGCs were recloned into pRSF-duett using the primers 5’-GTATAAGAAGGAGATATACAATGCATAATACCTTAAATGA-3’/ 5’ TGCTCAGCGGTGGCAGCAGCTTACGCCGCGATGGTTTGTT-3’ for all constructs to match the layout of pRSF-ADC5 and produced in E. coli Bap1 (Metab Eng 2021, 66, 123-136). |
| Collection Protocol Filename: | Collection_Protocol_Mutasynthetic_production_of_darobactin_analogs.docx |
| Sample Type: | Bacterial cells |
Treatment:
| Treatment ID: | TR002087 |
| Treatment Summary: | Purification of DaroB from the producer strain was achieved with a modified purification strategy from DaroA. Briefly, E. coli production strains were incubated for 5 days in a 2 L Erlenmeyer flask with 1 L LB medium supplemented with 50 μg/mL kanamycin at 30 °C. Cells were removed via centrifugation and the culture supernatant was mixed with XAD16N resin (Sigma-Aldrich) overnight under agitation. DaroB was subsequently eluted from the resin with a 50/50 solution of methanol and water, containing 0.1% formic acid. The eluate was then concentrated via rotary evaporator and loaded onto a cation-exchange column (SP Sepharose XL). DaroB was eluted by step gradients of 50 mM ammonium acetate pH 7, pH 8, and pH 10. Eluates were then concentrated by freeze drying, resuspended in Milli-Q water 0.1% (v/v) formic acid, and loaded onto a C18 reversed-phase high-performance liquid chromatography (RP-HPLC) column (Agilent, C18 5 µm: 250 x10mm, Restek). HPLC conditions for purification of DaroB are: solvent A, Milli-Q water and 0.1% (v/v) formic acid; solvent B, acetonitrile and 0.1% (v/v) formic acid. The initial concentration of 2% solvent B is maintained for 2 min, followed by a linear gradient to 26% B over 12 min with a flow rate of 5 mL min−1; UV detection by diode-array detector from 210 to 400 nm. Pure DaroB was then collected at 11.5 min. For purification of DaroE, fermentation broth was pelleted by centrifugation. The cell pellet was extracted using 80% acetonitrile and water by sonification. The resulting crude extract was fractionated by flash chromatography using a C18 F0120 column with the following gradient: 1) 0-28 min 5% ACN, 2) 28-37 min increased to 15% ACN, 3) 37-50 min, keeping 15% ACN, 4) 50-60 min, increased to 30% ACN, 5) 60-80 min, increased to 100% ACN and keeping 100% ACN for 15 min. By LCMS guided isolation, the DaroE-containing fraction was identified and further separated by HPLC using the following gradient: 1) 0-10 min 23% MeOH, 2)10-20 min increased to 50% MeOH, 3) 20-30 min increased to 100% MeOH, 4) 30-37 min 100% MeOH. Afterwards, the DaroE fraction was further purified by HPLC (gradient: 1) 0-5 min 25 %MeOH, 2) 5-45 min increased to 42.5% MeOH, 3) 45-52 min keeping 100% MeOH to obtain pure compound. For DaroD the same procedure via flash chromatography was followed. Then, the following HPLC gradient was applied: 1) 0-5 min 15% ACN, 2) 5-25 min increased to 25% ACN, 3) 25-30 min increased to 60% ACN, 4) 30-39 min 100% ACN. As before, a further HPLC separation followed to obtain DaroD as pure compound. |
| Treatment Protocol Filename: | Treatment_Protocol_Isolation_of_compounds.docx |
Sample Preparation:
| Sampleprep ID: | SP002081 |
| Sampleprep Summary: | For NMR analysis samples were dissolved in D2O. |
| Sampleprep Protocol Filename: | Sample Preparation Protocol_NMR Spectroscopy.docx |
Analysis:
| Analysis ID: | AN003251 |
| Analysis Type: | NMR |
| Num Factors: | 6 |
| Num Metabolites: | 1 |
| Units: | N/A (structure elucidation) |
NMR:
| NMR ID: | NM000224 |
| Analysis ID: | AN003251 |
| Instrument Name: | Bruker Avance III HD 600 MHz |
| Instrument Type: | FT-NMR |
| NMR Experiment Type: | Other |
| NMR Comments: | NMR spectra were recorded in D2O as solvent on an Avance III HD 600 MHz NMR spectrometer (Bruker BioSpin GmbH, Rheinstetten, Germany). 1H spectra were referenced to the residual solvent signal (delta = 4.79 ppm). For 13C measurements 3-(trimethylsilyl)propionic-2,2,3,3-d4 acid sodium salt (TSPA, delta = 1.7 ppm) was used as external standard. |
| Spectrometer Frequency: | 600 MHz |
| NMR Solvent: | D2O |
