Summary of Study ST004267
This data is available at the NIH Common Fund's National Metabolomics Data Repository (NMDR) website, the Metabolomics Workbench, https://www.metabolomicsworkbench.org, where it has been assigned Project ID PR002694. The data can be accessed directly via it's Project DOI: 10.21228/M8F26W This work is supported by NIH grant, U2C- DK119886.
See: https://www.metabolomicsworkbench.org/about/howtocite.php
This study contains a large results data set and is not available in the mwTab file. It is only available for download via FTP as data file(s) here.
| Study ID | ST004267 |
| Study Title | Histone deacetylase SIRT6 regulates tryptophan catabolism and prevents metabolite imbalance associated with neurodegeneration - Human cell lines |
| Study Summary | In the brain, tryptophan byproducts are involved in the biosynthesis of proteins, energy-rich molecules (e.g., NAD+), and neurotransmitters (serotonin and melatonin). Impaired tryptophan catabolism, seen in aging, neurodegeneration and psychiatric diseases affects mood, learning, and sleep; however, the reasons for those impairments in elder and these ailments remain unknown. Our results from cellular models indicate that SIRT6 regulates tryptophan catabolism by balancing its usage. Mechanistically, SIRT6 regulates tryptophan through changes in gene expression of key genes (e.g., TDO2, AANAT), which results in elevated concentration of neurotoxic metabolites from the kynurenic pathway, with a concomitant decrease in serotonin and melatonin production. |
| Institute | VIB-KU Leuven Center for Cancer Biology |
| Last Name | Fernández-García |
| First Name | Juan |
| Address | Campus Gasthuisberg, O&N4, Herestraat 49, box 912, 3000 Leuven, Belgium |
| juan.fernandezgarcia@kuleuven.be | |
| Phone | +32 16 37 32 61 |
| Submit Date | 2025-10-03 |
| Raw Data Available | Yes |
| Raw Data File Type(s) | mzML, d |
| Analysis Type Detail | LC-MS |
| Release Date | 2025-10-30 |
| Release Version | 1 |
Select appropriate tab below to view additional metadata details:
Project:
| Project ID: | PR002694 |
| Project DOI: | doi: 10.21228/M8F26W |
| Project Title: | Histone deacetylase SIRT6 regulates tryptophan catabolism and prevents metabolite imbalance associated with neurodegeneration |
| Project Summary: | In the brain, tryptophan byproducts are involved in the biosynthesis of proteins, energy-rich molecules (e.g., NAD+), and neurotransmitters (serotonin and melatonin). Impaired tryptophan catabolism, seen in aging, neurodegeneration and psychiatric diseases affects mood, learning, and sleep; however, the reasons for those impairments in elder and these ailments remain unknown. Our results from cellular, Drosophila melanogaster, and mouse models indicate that SIRT6 regulates tryptophan catabolism by balancing its usage. Mechanistically, SIRT6 regulates tryptophan and sleep quality through changes in gene expression of key genes (e.g., TDO2, AANAT), which results in elevated concentration of neurotoxic metabolites from the kynurenic pathway at the expense of serotonin and melatonin production. Such neurotoxic metabolites can affect various processes in the brain. However, by redirecting tryptophan through TDO2 inhibition in our new SIRT6-KO D. melanogaster model, the impairments in neuromotor behavior and vacuolar formation - parameters of neurodegeneration - could be significantly reversed. |
| Institute: | VIB-KU Leuven Center for Cancer Biology |
| Last Name: | Fernández-García |
| First Name: | Juan |
| Address: | Campus Gasthuisberg, O&N4, Herestraat 49, box 912, 3000 Leuven, Belgium |
| Email: | juan.fernandezgarcia@kuleuven.be |
| Phone: | +32 16 37 32 61 |
Subject:
| Subject ID: | SU004420 |
| Subject Type: | Cultured cells |
| Subject Species: | Homo sapiens |
| Taxonomy ID: | 9606 |
Factors:
Subject type: Cultured cells; Subject species: Homo sapiens (Factor headings shown in green)
| mb_sample_id | local_sample_id | Sample source | Genotype |
|---|---|---|---|
| SA497648 | ARPE19 CC2-2 | ARPE-19 | control |
| SA497649 | ARPE19 CC3-1 | ARPE-19 | control |
| SA497650 | ARPE19 CC3-2 | ARPE-19 | control |
| SA497651 | ARPE19 CC2-1 | ARPE-19 | control |
| SA497644 | ARPE19 C32-2 | ARPE-19 | SIRT6 KO |
| SA497645 | ARPE19 C32-1 | ARPE-19 | SIRT6 KO |
| SA497646 | ARPE19 C33-2 | ARPE-19 | SIRT6 KO |
| SA497647 | ARPE19 C33-1 | ARPE-19 | SIRT6 KO |
| SA497656 | Hela cc3-2 | HeLa | control |
| SA497657 | Hela cc3-1 | HeLa | control |
| SA497658 | Hela cc2-1 | HeLa | control |
| SA497659 | Hela cc2-2 | HeLa | control |
| SA497652 | Hela c32-1 | HeLa | SIRT6 KO |
| SA497653 | Hela c32-2 | HeLa | SIRT6 KO |
| SA497654 | Hela c33-1 | HeLa | SIRT6 KO |
| SA497655 | Hela c33-2 | HeLa | SIRT6 KO |
| SA497660 | Mock01 | Mock | NA |
| SA497661 | Mock02 | Mock | NA |
| SA497666 | SHSY5Y cc2-1 | SH-SY5Y | control |
| SA497667 | SHSY5Y cc2-2 | SH-SY5Y | control |
| SA497668 | SHSY5Y cc3-1 | SH-SY5Y | control |
| SA497669 | SHSY5Y cc3-2 | SH-SY5Y | control |
| SA497662 | SHSY5Y c32-1 | SH-SY5Y | SIRT6 KO |
| SA497663 | SHSY5Y c32-2 | SH-SY5Y | SIRT6 KO |
| SA497664 | SHSY5Y c33-1 | SH-SY5Y | SIRT6 KO |
| SA497665 | SHSY5Y c33-2 | SH-SY5Y | SIRT6 KO |
| Showing results 1 to 26 of 26 |
Collection:
| Collection ID: | CO004413 |
| Collection Summary: | Cell lines (SH-SY5Y, HeLa, ARPE-19) were cultured in Dulbecco’s Minimal Essential Medium (DMEM with 4.5g/L glucose) or DMEM/F-12 (only ARPE-19 cell line), in an atmosphere with 5% CO2 at 37°C. Media were supplemented with 10% fetal bovine serum (FBS), 1% penicillin and streptomycin cocktail, and 1% L-glutamine. |
| Sample Type: | Cultured cells |
Treatment:
| Treatment ID: | TR004429 |
| Treatment Summary: | SH-SY5Y, HeLa, and ARPE-19 SIRT6 KO cells were generated as described previously in Kaluski et al. 2017 (doi: 10.1016/j.celrep.2017.03.008). Briefly, cells were infected with the lentivirus GeCKO system. We used 2 sgRNA molecules, targeting Sirt6 CRISPR2 (GCTGTCGCCGTACGCGGACA) and CRISPR3 (GCTCCACGGGAACATGTTTG), and scrambled gRNA as a control. Constructions were kindly donated by the Prof. Aharoni lab (Ben-Gurion University, Israel). Cells were selected by means of 2 μg/mL puromycin for a week, followed by serial dilutions to a single cell colony. |
Sample Preparation:
| Sampleprep ID: | SP004426 |
| Sampleprep Summary: | Cell lines (SH-SY5Y, HeLa, ARPE-19) metabolite extraction was performed in a mixture of ice/dry ice, by a cold two-phase methanol–water–chloroform solution. The samples were resuspended in 800 μl of precooled methanol/water (5:3 v/v). Afterwards, 500 μl of precooled chloroform was added to each sample. Samples were vortexed for 10 min at 4 °C and then centrifuged (max. speed, 10 min, 4 °C). The methanol–water phase containing polar metabolites was separated and dried using a vacuum concentrator at 4 °C overnight, and then stored at -80 °C until sample preparation for LC-MS analysis. Polar metabolite extracts previously stored at -80 °C were resuspended in 50 µL of water prior to LC-MS analysis. |
| Processing Storage Conditions: | Described in summary |
| Extract Storage: | Described in summary |
Chromatography:
| Chromatography ID: | CH005396 |
| Chromatography Summary: | For the detection of tryptophan derivatives by LC–MS, we used an Infinity II 1290 liquid chromatography system (Agilent Technologies) with a thermal autosampler set at 4°C. Samples were resuspended in 50 µL of water, and 20 µL of each sample were injected onto a C18 column (Acquity UPLC Premier HSS C18 1.8 μm 2.1 × 100 mm). Metabolite separation was achieved with a flow rate of 0.25 ml/min at 30°C, and based on the following 40-minute gradient (solvent A = H2O, 0.1% Formic acid, 15 mM acetic acid; solvent B = Acetonitrile + 0.1% Formic acid): 0 min 8% B; 2 min 8% B; 14 min 90% B; 16 min 90% B; 17 min 8% B; 22 min 8% B. |
| Instrument Name: | Agilent 1290 Infinity II |
| Column Name: | Waters ACQUITY UPLC HSS T3 (100 x 2.1 mm, 1.8 μm) |
| Column Temperature: | 30°C |
| Flow Gradient: | 0 min 8% B; 2 min 8% B; 14 min 90% B; 16 min 90% B; 17 min 8% B; 22 min 8% B |
| Flow Rate: | 0.25 mL/min |
| Solvent A: | 100% water; 0.1% formic acid; 15 mM acetic acid |
| Solvent B: | 100% acetonitrile; 0.1% formic acid |
| Chromatography Type: | Reversed phase |
Analysis:
| Analysis ID: | AN007103 |
| Analysis Type: | MS |
| Chromatography ID: | CH005396 |
| Num Factors: | 7 |
| Num Metabolites: | 5 |
| Units: | Peak Area |
