Return to study ST001995 main page
MB Sample ID: SA186770
| Local Sample ID: | SA184027 |
| Subject ID: | SU002076 |
| Subject Type: | Bacteria |
| Subject Species: | Escherichia coli |
| Taxonomy ID: | 679895 |
| Genotype Strain: | BW25113 |
Select appropriate tab below to view additional metadata details:
Subject:
| Subject ID: | SU002076 |
| Subject Type: | Bacteria |
| Subject Species: | Escherichia coli |
| Taxonomy ID: | 679895 |
| Genotype Strain: | BW25113 |
Factors:
| Local Sample ID | MB Sample ID | Factor Level ID | Level Value | Factor Name |
|---|---|---|---|---|
| SA184027 | SA186770 | FL023100 | CCTAAGATCCCTGAGATCACGGCCTGGAACTGGTCAAGAAGCTTC | Forward Primer |
| SA184027 | SA186770 | FL023100 | TTTAGAAGCTTCTTGACCAGTTCCAGGCCGTGATCTCAGGGATCT | Reverse Primer |
Collection:
| Collection ID: | CO002069 |
| Collection Summary: | E. coli strains for cloning and expression were grown in LB broth or on agar medium supplemented with appropriate antibiotics or supplements at 37° C or 30° C using standard working concentrations. Plasmid DNA was isolated using the innuPREP plasmid mini kit 2.0 (AnalytikJena, Jena, Germany) according to the manufacturer’s protocol. Genomic DNA was extracted using the innuPREP bacteriaDNA kit (AnalytikJena, Jena, Germany). PCR amplification for cloning purposes was performed using Q5 DNA polymerase (NEB Biolabs, New Brunswick, USA) according to the given instruction. Restriction digestion was performed using standard techniques and employing NEB enzymes (NEB Biolabs, New Brunswick, USA). DNA fragments were analysed on and excised from 1% or 2% TAE-agarose with GeneRuler 1kb Plus (ThermoFisher, Waltham, USA) as marker. DNA for cloning purposes was purified using the Zymoclean large fragment DNA recovery kit according to manufacturer’s instruction. DNA concentrations were determined photometrically with an Eppendorf BioSpectrometer (Eppendorf AG, Hamburg, Germany) using a 1 mm light path UV cuvette. DNA fragments to be fused by isothermal assembly were gel purified and fused using self-made isothermal assembly master mix (Nat Methods 2009, 6, 343–345) using NEB enzymes (NEB Biolabs, New Brunswick, USA). Assembled plasmids were transferred to E. coli cells using standard electroporation protocols (Nature 2019, 576, 459-464, Metab Eng 2021, 66, 123-136). Construcion of pNBDaroMod for modification of the precursor peptide was performed by linearising pNB03 (Nature 2019, 576, 459-464) by PCR using 5’ TCCCTTAACGTGAGTTTTCG-3’/ 5’-TTTTATAACCTCCTTAGAGCTCGAA-3’, amplification of truncated (3’ minus 50 nt) darA using 5’ GCTCTAAGGAGGTTATAAAAATGCATAATACCTTAAATGAAACCGTTAAA-3’/ 5’-TAGGTTTATTGCTTAATTCGTTTAGTGCTT-3’, the lacZ spacer from pCRISPOMYCES-2 (5’ CGAATTAAGCAATAAACCTAAAGTCTTCTCAGCCGCTACA-3’/ 5’ ACCTGATGGGATAAGCTTTAATGTCTTCACCGGTGGAAAG-3’) and the rest of the P. khanii DSM3369 BGC using 5’-TAAAGCTTATCCCATCAGGTTATTT-3’/ 5’ CGAAAACTCACGTTAAGGGATTACGCCGCGATGGTTTGTTTTATT-3’ and subsequent isothermal assembly of the plasmid. After transformation and selection on LBKan/Apra/IPTG/X-gal, blue colonies were picked and the correct assembly of the plasmid was corroborated by test restriction. AA modifications were designed in silico and ordered as complementary oligonucleotides with 4 nt overlap to the pNBDaroMod backbone. Oligonucleotides were annealed and assembled into pNBDaroMod using the protocol described in ACS Synth Biol 2015, 4, 723-728 and the resulting plasmids were transferred to E. coli BW25113 and selected on LBKan/Apra/IPTG/X-gal. White colonies were picked and grown in LBKan/IPTG for three days at 220 rpm and 30° C. The correct assembly of the plasmid was corroborated by UHPLC-MS profiling, i.e. detection of the expected product ion. For increased production titter, the modified BGCs were recloned into pRSF-duett using the primers 5’-GTATAAGAAGGAGATATACAATGCATAATACCTTAAATGA-3’/ 5’ TGCTCAGCGGTGGCAGCAGCTTACGCCGCGATGGTTTGTT-3’ for all constructs to match the layout of pRSF-ADC5 and produced in E. coli Bap1 (Metab Eng 2021, 66, 123-136). |
| Collection Protocol Filename: | Collection_Protocol_Mutasynthetic_production_of_darobactin_analogs.docx |
| Sample Type: | Bacterial cells |
Treatment:
| Treatment ID: | TR002088 |
| Treatment Summary: | Purification of DaroB from the producer strain was achieved with a modified purification strategy from DaroA. Briefly, E. coli production strains were incubated for 5 days in a 2 L Erlenmeyer flask with 1 L LB medium supplemented with 50 μg/mL kanamycin at 30 °C. Cells were removed via centrifugation and the culture supernatant was mixed with XAD16N resin (Sigma-Aldrich) overnight under agitation. DaroB was subsequently eluted from the resin with a 50/50 solution of methanol and water, containing 0.1% formic acid. The eluate was then concentrated via rotary evaporator and loaded onto a cation-exchange column (SP Sepharose XL). DaroB was eluted by step gradients of 50 mM ammonium acetate pH 7, pH 8, and pH 10. Eluates were then concentrated by freeze drying, resuspended in Milli-Q water 0.1% (v/v) formic acid, and loaded onto a C18 reversed-phase high-performance liquid chromatography (RP-HPLC) column (Agilent, C18 5 µm: 250 x10mm, Restek). HPLC conditions for purification of DaroB are: solvent A, Milli-Q water and 0.1% (v/v) formic acid; solvent B, acetonitrile and 0.1% (v/v) formic acid. The initial concentration of 2% solvent B is maintained for 2 min, followed by a linear gradient to 26% B over 12 min with a flow rate of 5 mL min−1; UV detection by diode-array detector from 210 to 400 nm. Pure DaroB was then collected at 11.5 min. For purification of DaroE, fermentation broth was pelleted by centrifugation. The cell pellet was extracted using 80% acetonitrile and water by sonification. The resulting crude extract was fractionated by flash chromatography using a C18 F0120 column with the following gradient: 1) 0-28 min 5% ACN, 2) 28-37 min increased to 15% ACN, 3) 37-50 min, keeping 15% ACN, 4) 50-60 min, increased to 30% ACN, 5) 60-80 min, increased to 100% ACN and keeping 100% ACN for 15 min. By LCMS guided isolation, the DaroE-containing fraction was identified and further separated by HPLC using the following gradient: 1) 0-10 min 23% MeOH, 2)10-20 min increased to 50% MeOH, 3) 20-30 min increased to 100% MeOH, 4) 30-37 min 100% MeOH. Afterwards, the DaroE fraction was further purified by HPLC (gradient: 1) 0-5 min 25 %MeOH, 2) 5-45 min increased to 42.5% MeOH, 3) 45-52 min keeping 100% MeOH to obtain pure compound. For DaroD the same procedure via flash chromatography was followed. Then, the following HPLC gradient was applied: 1) 0-5 min 15% ACN, 2) 5-25 min increased to 25% ACN, 3) 25-30 min increased to 60% ACN, 4) 30-39 min 100% ACN. As before, a further HPLC separation followed to obtain DaroD as pure compound. |
| Treatment Protocol Filename: | Treatment_Protocol_Isolation_of_compounds.docx |
Sample Preparation:
| Sampleprep ID: | SP002082 |
| Sampleprep Summary: | LCMS samples from culture supernatant, were desalted and concentrated ~ 6 times using C18 stage tips before LCMS analysis. Stage tips were washed with 200 μL 100 % MeOH and equilibrated using 200 μL 95:5 H2O/MeCN + 0.1 % FA and centrifugation at 3000 rcf. Subsequently, 400 - 500 μL of cleared supernatant were applied to the stage tips and the C18 matrix was washed with 30 μL 95:5 H2O/MeCN + 0.1 % FA to remove salts. Finally, the samples were eluted using two times 30 μL 20:80 H2O/MeCN + 0.1 % FA. For LCMS analysis of the pellet, cells were harvested by centrifugation and the pellet was resuspended in 10 % of the harvested volume 20:80 H2O/MeCN + 0.1 % FA. The resulting suspension was sonicated for 10 min. Subsequently any cell debris was removed by centrifugation at maximum speed for 10 min. |
| Sampleprep Protocol Filename: | Sample Preparation Protocol_Mass_Spectrometry.docx |
Combined analysis:
| Analysis ID | AN003252 | AN003253 | AN003254 |
|---|---|---|---|
| Analysis type | MS | MS | MS |
| Chromatography type | Reversed phase | Reversed phase | Reversed phase |
| Chromatography system | Thermo Dionex Ultimate 3000 | Agilent 1290 Infinity | Agilent 1290 Infinity |
| Column | Macherey-Nagel EC 100/2 Nucleoshell C18 2.7μm | Waters Acquity BEH C18 (100 x 2mm,1.7um) | Waters Acquity BEH C18 (100 x 2mm,1.7um) |
| MS Type | ESI | ESI | ESI |
| MS instrument type | QTOF | QTOF | QTOF |
| MS instrument name | Bruker micrOTOFQ II | Bruker micrOTOFQ II | Bruker maXis II |
| Ion Mode | POSITIVE | POSITIVE | POSITIVE |
| Units | N/A (structure elucidation) | N/A (structure elucidation) | N/A (structure elucidation) |
Chromatography:
| Chromatography ID: | CH002396 |
| Chromatography Summary: | Standard LCMS measurements were performed on a Dionex Ultimate3000 (Thermo Scientific, Darmstadt, Germany) using an EC 100/2 Nucleoshell C18 2.7μm column (Macherey-Nagel, Düren, Germany) HPLC coupled to a micrOTOFQ II (Bruker Daltonics, Bremen, Germany) ESI-qTOF-HRMS. The LC system was run in the following gradient (A:H2O; B: MeOH, ; Flow: 200 μL/min): 0 min: 90% A, 5 min: 90% A, 35min: 0% A, 50min: 0% A, 51min: 90% A, 60 min: 90% A. The injection volume was 5 µL. |
| Methods Filename: | Chromatography_Protocol.docx |
| Instrument Name: | Thermo Dionex Ultimate 3000 |
| Column Name: | Macherey-Nagel EC 100/2 Nucleoshell C18 2.7μm |
| Flow Gradient: | 0 min: 90% A, 5 min: 90% A, 35min: 0% A, 50min: 0% A, 51min: 90% A, 60 min: 90% A |
| Flow Rate: | 200 μL/min |
| Solvent A: | 100% water |
| Solvent B: | 100% methanol |
| Chromatography Type: | Reversed phase |
| Chromatography ID: | CH002397 |
| Chromatography Summary: | Alternatively, a setup consisting of an Agilent Infinity 1290 UPLC system (Agilent, Santa Clara, CA, USA) equipped with an Acquity UPLC BEH C18 1.7 μm (2.1 × 100 mm) column and an Acquity UPLC BEH C18 1.7 μm VanGuard Pre-Column (2.1 × 5 mm; both columns purchased from Waters, Eschborn, Germany) coupled to a DAD detector and a micrOTOFQ II mass spectrometer (Bruker Daltonics, Bremen, Germany) with an electrospray ionization source was employed. The LC system was operated using a gradient (A: H2O, 0.1% formic acid; B: MeCN, 0.1% formic acid; flow: 600 μL/min): 0 min: 95% A; 0.80 min: 95% A; 18.70 min: 4.75% A; 18.80 min: 0% A; 23.00 min: 0% A; 23.10 min: 95% A; 25.00 min: 95% A and the column oven temperature was set to 45 °C. The injection volume was 5 µL. |
| Methods Filename: | Chromatography_Protocol.docx |
| Instrument Name: | Agilent 1290 Infinity |
| Column Name: | Waters Acquity BEH C18 (100 x 2mm,1.7um) |
| Column Temperature: | 45 °C |
| Flow Gradient: | 0 min: 95% A; 0.80 min: 95% A; 18.70 min: 4.75% A; 18.80 min: 0% A; 23.00 min: 0% A; 23.10 min: 95% A; 25.00 min: 95% A |
| Flow Rate: | 600 μL/min |
| Solvent A: | 100% water; 0.1% formic acid |
| Solvent B: | 100% methanol; 0.1% formic acid |
| Chromatography Type: | Reversed phase |
| Chromatography ID: | CH002398 |
| Chromatography Summary: | High accuracy measurements were performed on a 1290 UHPLC system (Agilent, Santa Clara, CA, USA) equipped with DAD, ELSD and maXis II™ (Bruker, Billerica, MA, USA) ESI-qTOF-UHRMS with the following gradient: 0 min: 95% A; 0.30 min: 95% A; 18.00 min: 4.75% A; 18.10 min: 0% A; 22.50 min: 0% A; 22.60 min: 95% A; 25.00 min: 95% A (A: H2O, 0.1% formic acid; B: acetonitrile, 0.1% formic acid; flow: 600 μL/min). The employed column was an Acquity UPLC BEH C18 1.7 μm (2.1 × 100 mm) column with an Acquity UPLC BEH C18 1.7 μm VanGuard Pre-Column (2.1 × 5 mm). The column oven temperature was maintained at 45°C. The injection volume was either 1 or 2 µL. |
| Methods Filename: | Chromatography_Protocol.docx |
| Instrument Name: | Agilent 1290 Infinity |
| Column Name: | Waters Acquity BEH C18 (100 x 2mm,1.7um) |
| Column Temperature: | 45 °C |
| Flow Rate: | 600 μL/min |
| Solvent A: | 100% water; 0.1% formic acid |
| Solvent B: | 100% methanol; 0.1% formic acid |
| Chromatography Type: | Reversed phase |
MS:
| MS ID: | MS003024 |
| Analysis ID: | AN003252 |
| Instrument Name: | Bruker micrOTOFQ II |
| Instrument Type: | QTOF |
| MS Type: | ESI |
| MS Comments: | For standard measurements on the Dionex Ultimate 3000 + Bruker micrOTOFQ II system MS data was acquired over a range from 50 to 2000 m/z in positive mode. Auto MS/MS fragmentation was achieved with rising collision energy (for single charged ions: 18–45 eV over a gradient from 100 to 1000 m/z; for double charged ions: 15–32 eV over a gradient from 100 to 1000 m/z). Calibration of mass spectra was achieved using 10 mM sodium formate in H2O/ iPrOH (1:1) as internal standard. Mass spectra were analysed using Bruker Data Analysis 4.2 software (Bruker Daltonics, Bremen, Germany). Masses of the expected compounds were determined using ChemDraw Professional 16.0.1.4 (PerkinElmer, Waltham, USA) and recorded chromatograms were extracted for the respective m/z. Ions with fitting m/z (Δ<10 ppm) and plausible retention time were fragmented and fragments were matched to in silico identified plausible decay products. |
| Ion Mode: | POSITIVE |
| Capillary Voltage: | 3500 |
| Analysis Protocol File: | Mass_Spectrometry_Protocol.docx |
| MS ID: | MS003025 |
| Analysis ID: | AN003253 |
| Instrument Name: | Bruker micrOTOFQ II |
| Instrument Type: | QTOF |
| MS Type: | ESI |
| MS Comments: | For standard measurements on the Agilent Infinity 1290 + Bruker micrOTOFQ II system MS data was acquired over a range from 100 to 1500 m/z in positive mode. Auto MS/MS fragmentation was achieved with rising collision energy (for single charged ions: 18–45 eV over a gradient from 100 to 1000 m/z; for double charged ions: 15–32 eV over a gradient from 100 to 1000 m/z). Calibration of mass spectra was achieved using 10 mM sodium formate in H2O/ iPrOH (1:1) as internal standard. Mass spectra were analysed using Bruker Data Analysis 4.2 software (Bruker Daltonics, Bremen, Germany). Masses of the expected compounds were determined using ChemDraw Professional 16.0.1.4 (PerkinElmer, Waltham, USA) and recorded chromatograms were extracted for the respective m/z. Ions with fitting m/z (Δ<10 ppm) and plausible retention time were fragmented and fragments were matched to in silico identified plausible decay products. |
| Ion Mode: | POSITIVE |
| Capillary Voltage: | 3500 |
| Analysis Protocol File: | Mass_Spectrometry_Protocol.docx |
| MS ID: | MS003026 |
| Analysis ID: | AN003254 |
| Instrument Name: | Bruker maXis II |
| Instrument Type: | QTOF |
| MS Type: | ESI |
| MS Comments: | For standard measurements on the Agilent Infinity 1290 + Bruker maXis II system MS data was acquired over a range from 50 to 2000 m/z in positive mode. Auto MS/MS fragmentation was achieved with rising collision energy (for single charged ions: 35–70 eV over a gradient from 500 to 2000 m/z; for double charged ions: 25–50 eV over a gradient from 500 to 2000 m/z). Calibration of mass spectra was achieved using sodium formate in H2O/ iPrOH (1:1) as internal standard. Mass spectra were analysed using Bruker Data Analysis 4.2 software (Bruker Daltonics, Bremen, Germany). Masses of the expected compounds were determined using ChemDraw Professional 16.0.1.4 (PerkinElmer, Waltham, USA) and recorded chromatograms were extracted for the respective m/z. Ions with fitting m/z (Δ<10 ppm) and plausible retention time were fragmented and fragments were matched to in silico identified plausible decay products. |
| Ion Mode: | POSITIVE |
| Capillary Voltage: | 4500 |
| Analysis Protocol File: | Mass_Spectrometry_Protocol.docx |
